Part:BBa_K5005002:Design
The BFP protein is located downstream of the T7 promoter.
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 8002
Illegal NheI site found at 315
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 1053
Illegal NotI site found at 8008 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 8002
Illegal BglII site found at 2719
Illegal BglII site found at 2785
Illegal BglII site found at 2826
Illegal BglII site found at 6250
Illegal BamHI site found at 1047 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 8002
Illegal suffix found at 2 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 8002
Plasmid lacks a suffix.
Illegal XbaI site found at 8017
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NgoMIV site found at 1571
Illegal NgoMIV site found at 2604 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI site found at 2808
Illegal BsaI site found at 6232
Illegal BsaI.rc site found at 1524
Illegal BsaI.rc site found at 4673
Illegal SapI site found at 3590
Illegal SapI.rc site found at 6881
Design Notes
The Target plasmid expresses the target gene BFP (blue fluorescence), derived from site-directed mutagenesis of EGFP, which has the potential to be evolved back into EGFP by the Editor. BFP is positioned downstream of the T7 promoter, enabling specific editing of EBFP by the Editor. If the TRACE system operates effectively, it is feasible to observe cells where blue fluorescence is converted into green fluorescence.
Primer EGFP-F:atagggattccagagctagcgaatttatggtgagcaagggcgagga and EGFP-R: tgtagtctgcggccgcggatccttacttgtacagctcgtccatgcc were used to insert EGFP(BBa_K5005001) into pTarget (BBa_K5005012). Primer BFP-F:acttcaagatccgccacaacatcgaggacggcagcgtgc and BFP-R:tgtggcggatcttgaagttcaccttgatgccgttcttctgct were used to converted EGFP(BBa_K5005001) to BFP (BBa_K5005000).
Source
Constructed in this work.
References
Chen, H., Liu, S., Padula, S., Lesman, D., Griswold, K., Lin, A., Zhao, T., Marshall, J. L., & Chen, F. (2020). Efficient, continuous mutagenesis in human cells using a pseudo-random DNA editor. Nature biotechnology, 38(2), 165–168. https://doi.org/10.1038/s41587-019-0331-8